Разработка метода аллель-специфичной истощающей ПЦР для определения однонуклеотидных замен в геноме Mycobacterium tuberculosis
Автор глубоко признателен своим научным руководителям, Светлане Алексеевне Дубилей и Игорю Георгиевичу Шемякину, под чьим непосредственным руководством выполнялась настоящая работа, а также заведующему лабораторией член-корреспонденту РАН Александру Габибовичу Габибову. Автор также благодарен всем сотрудникам Лаборатории биокатализа, принимавшим живейшее участие в судьбе данной работы. Автор… Читать ещё >
Содержание
- СПИСОК СОКРАЩЕНИЙ
- ГЛАВА 1. МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ ВОЗНИКНОВЕНИЯ УСТОЙЧИВОСТИ MYCOBACTERIUM TUBERCULOSIS К АНТИБИОТИКАМ И МЕТОДЫ ОПРЕДЕЛЕНИЯ РЕЗИСТЕНТНОСТИ. ОБЗОР ЛИТЕРАТУРЫ
- 1. 1. История распространения туберкулеза
- 1. 2. Подходы к лечению туберкулеза
- 1. 3. Противотуберкулезные антибиотики
- 1. 4. Развитие устойчивости М. tuberculosis к антибиотикам
- 1. 5. Механизмы устойчивости к отдельным противотуберкулезным препаратам
- Рифампицин
- Изониазид
- Стрептомицин
- Пиразинамид
- Этамбутол
- Фторхинолоны
- Канамицин, амикацин, виомицин, капреомицин
- 1. 6. Методы диагностики лекарственной устойчивости
- Микробиологические методы
- Молекулярно-биологические методы
Разработка метода аллель-специфичной истощающей ПЦР для определения однонуклеотидных замен в геноме Mycobacterium tuberculosis (реферат, курсовая, диплом, контрольная)
Туберкулез — одно их наиболее распространенных инфекционных заболеваний человека. Эта болезнь является одним из старейших врагов человечества. Примерно треть населения Земли инфицирована туберкулезом, и каждый год эта болезнь уносит 2 миллиона жизней. Несмотря на существование эффективной терапии, заболеваемость туберкулезом во всем мире продолжает расти, причем особенностью современной эпидемии является распространение лекарственно-устойчивых форм болезни.
Для проведения успешного лечения особое внимание должно уделяться определению спектра и уровней чувствительности микобактериальных культур. Поскольку М. tuberculosis медленно растущая бактерия, стандартные микробиологические тесты для определения устойчивости могут занимать от нескольких недель до двух месяцев. В этой связи особое значение приобретает разработка быстрых и высокоэффективных методов определения лекарственной чувствительности клинических изолятов М. tuberculosis. Молекулярно-генетические методы определения устойчивости обладают важным преимуществом, так как позволяют сократить время необходимое для получения результатов до нескольких дней или даже часов.
Таким образом, разработка эффективного метода детекции однонуклеотидных замен в геноме М. tuberculosis является одной из актуальных проблем современной молекулярной диагностики, филогенетики и эпидемиологии.
ГЛАВА 1. МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ ВОЗНИКНОВЕНИЯ УСТОЙЧИВОСТИ MYCOBACTERIUM TUBERCULOSIS К АНТИБИОТИКАМ И МЕТОДЫ ОПРЕДЕЛЕНИЯ РЕЗИСТЕНТНОСТИ. ОБЗОР ЛИТЕРАТУРЫ.
выводы.
1. Разработан метод аллель-специфичной истощающей ПЦР, позволяющий повысить аллельную дискриминацию за счет дополнительной амплификации консервативного участка генома.
2. На основе метода разработаны тест-системы для определения точечных мутаций в генах rpoB, katG, embB и gyrA, приводящих к устойчивости М. tuberculosis к антибиотикам.
3. Показана возможность применения аллель-специфичной истощающей ПЦР для анализа гетерорезистентных культур М. tuberculosis. Метод позволяет детектировать 5 и менее % примеси устойчивых к рифампицину и изониазиду бактерий.
4. При исследовании 116 клинических изолятов М. tuberculosis с помощью разработанных тест-систем для идентификации мутаций в генах гроВ и katG, устойчивость к рифампицину и изониазиду была корректно определена в 95% и 100% случаев, соответственно.
5. Разработан экспресс-метод идентификации основных филогенетических групп бактерий туберкулезного комплекса. Была показана возможность выявления смешаных культур, состоящих из нескольких изолятов М. tuberculosis.
БЛАГОДАРНОСТИ.
Автор глубоко признателен своим научным руководителям, Светлане Алексеевне Дубилей и Игорю Георгиевичу Шемякину, под чьим непосредственным руководством выполнялась настоящая работа, а также заведующему лабораторией член-корреспонденту РАН Александру Габибовичу Габибову. Автор также благодарен всем сотрудникам Лаборатории биокатализа, принимавшим живейшее участие в судьбе данной работы. Автор выражает глубокую признательность сотрудникам кафедры молекулярной биологии Биологического факультета Московского Государственного Университета имени М. В. Ломоносова за полученные знания, а также за высокую требовательность и постоянное внимание.
Заключение
.
Таким образом, нами был разработан метод аллель-специфичной истощающей ПЦР, позволяющий повысить аллельную дискриминацию за счет одновременной амплификации аллель-специфичного продукта и не связанного с анализируемой последовательностью участка генома. Разработанный метод был применен для детекции мутаций, приводящих к устойчивости М. tuberculosis к рифампицину, изониазиду, этамбутолу и фторхинолонам. Амплификация вспомогательного продукта (фрагмента гена mtp40 или мобильного элемента IS6110) в АСИ ПЦР позволяет одновременно определять видовую принадлежность исследуемого образца, а также является контролем качества ДНК-матрицы, используемой для ПЦР. Кроме быстрой детекции устойчивости к антибиотикам, описанные методы предоставляют эпидемиологически важную информацию о том, какие именно мутации приводят к резистентности, и могут быть применены как важное дополнение к стандартным микробиологическим тестам. Динамический диапазон метода АСИ ПЦР позволяет идентифицировать смешанные образцы, в которых представлены два или более аллельных варианта. Таким образом, метод АСИ ПЦР может иметь важное практическое применение для выявления лабораторных контаминаций, изучения случаев множественной инфекции и анализа гетерорезистентных культур М. tuberculosis.
ГЛАВА III. ПРАКТИЧЕСКАЯ ЧАСТЬ Материалы.
В работе было использовано следующее оборудование: центрифуги Eppendorf 5415D (Eppendorf, Германия), Sigma 301К и Sigma 2К15 (Sigma, Германия) — УФ-трансиллюминатор 2011 Macrovue (LKB, Швеция) — система для документирования и анализа результатов электрофореза (UVP, США) — спектрофотометр DU-70 (Beckman, США) — рН-метр CyberScan 1100 (Eutech Instruments/Oakton Instruments) — термостат суховоздушный ТС 1/20 СПУ (Россия) — термостат Thermolyne 17 600 (Barnstead, США) — приборы для горизонтального электрофореза Wide Mini-Sub Cell GT, Sub Cell 192 (BioRad, США) — прибор для вертикального электрофореза BioRad Sequi-Gen Sequencing Cell (BioRad, США) — прибор для переноса Vacuum Blotter model 785 (BioRad, США) — прибор для фиксации ДНК на нитроцеллюлозном фильтре с помощью ультрафиолетового света UVC 500 UV Crosslinker, Hoeferисточник питания 2197 Power supply (LKB, США) — ПЦР-амплификатор РТС-200 Peltier Thermal Cycler, (MJ Research, США), гибридизационный инкубатор Hybridization oven/shaker (Amersham Pharmacia, Великобритания) — автоматические пипетки (Gilson, Франция) — весы Sartorius laboratory (Sartorius, Германия) — настольный инкубаторный шейкер Innova 4000 (New Brunswick Scientific, США) — прибор для перемешивания растворов с подогревом MR 3001 (Heidolph, Германия) — ламинарный шкаф Flow laboratories BSB 4А (Gelaire, Italy), система для ПЦР в реальном времени ABI Prism 7000 Sequence Detection System (Applied Biosystems, США).
В работе использовали следующие расходные материалыпластиковые наконечники и пластиковые пробирки для ПЦР на 0.2 и 0.5 мл (Treff Lab, Швейцария) — пластиковые микроцентрифужные пробирки на 1.5 и 2.0 мл — эппендорфы (Eppendorf, Германия) — одноразовые центрифужные пробирки на 15 мл и 50 мл Corning (США) — одноразовые чашки Петри Завода Медицинских Полимеров (Россия) — рентгеновская пленка AGFA (Бельгия), пленка для детекции хемилюминесценции Hyperfilm (Amersham Biosciences, Великобритания) — нейлоновая мембрана Hybond N+ (Amersham, США) — нитроцеллюлозные фильтры с диаметром пор 0.22 мкм и 0.45 мкм (Millipore, США) — набор реактивов для определения последовательности ДНК CycleReader (Fermentas, Литва) — набор реактивов для мечения и детекции нуклеиновых кислот ECL Direct Nucleic Acid Labelling and Detection System (Amersham Biosciences, Великобритания) — ДНК-маркеры длин 1 т.п.о. (1 kb DNA Ladder) и 100+1500 п.о. (100 bp DNA Ladder) (SibEnzyme, Россия).
В работе использовали следующие реактивы: трис-гидроксиметиламинометан (трис), тетраборат натрия, этилендиаминтетрауксусную кислоту (ЭДТА), этиловый спирт, изопропиловый спирт, уксусная кислота, однократно перегнанный фенол, хлороформ, бромистый этидий, акриламид, №,№-метиленбисакриламид, додецилсульфат натрия (ДСН), мочевину (sequence grade) — агар, триптон, дрожжевой экстракт (Difco, Великобритания) — Repel-silane, Bind-silane (LKB, Швеция) — агароза LE Molecular Biology Grade (Promega, США) — бромфеноловый синий (Bio-Rad, США) — ксиленцианол (Bio-Rad, США) — дезоксирибонуклеозидтрифосфаты (Roche Diagnostics, Германия) — остальные реактивы отечественного производства марки «осч» (особо чистые) — плазмиды: pGEM5Zштаммы Е. coli: DH5a — supE44, delta lacU169 (phi 80 lacZ delta M15), hsdR17, recAl, endAl, gyrA96, thi-1, relAl (Gibco, Великобритания), эндонуклеаза рестрикции PvuII и буфер G для рестрикции (Fermentas, Литва). Растворы.
TBE IPX: 0.89 M трис, 0.89 M борная кислота, 20 мМ ЭДТА, pH 8.0 ТАЕ 50Х: 2 M трис, 0.05 M ЭДТА.
Буфер для нанесения образцов ДНК на агарозный гель — 0.1% бромфеноловый синий, 0.1% ксиленцианол, 30% глицерин.
Буфер для Тад-полимеразы — 2 мМ MgS04,25 мМ KCl, 10 мМ Трис-HCl, pH 8.85.
Буфер SSC (20х) — 3 M NaCl, 0.3 M цитрат натрия.
Депуринизирующий раствор — 0.25 M HCl.
Денатурирующий раствор — 1.5 M NaCl, 0.5 M NaOH.
Нейтрализующий раствор — 0.5 M Трис-HCl, 1.5 M NaCl, pH 7.1.
Отмывочные растворы для гибридизации: 1) — 0.5х SSC, 0.4% SDS- 2) -2х SSC.
Микробиологические среды. LB: 10 г/л бактотриптона, 5 г/л дрожжевого экстракта, 10 г/л NaCl LB-агар: LB, 18 г/л агара.
2xYT: 16 г/л бактотриптона, 10 г/л дрожжевого экстракта, 10 г/л NaCl.
SOB: 20 г/л бактотриптона, 5 г/л дрожжевого экстракта, 0.5 г/л NaCl, 250 мМ KCl,.
10 мМ MgCl2.
SOC: SOB, 50 мМ глюкоза.
Препараты, меченные радиоактивными изотопами- [а-33Р]АТР, (>5000 Ки/ммоль) — ГНЦ РФ ФЭИ, Обнинск, Россия.
Образцы ДНК.
Образцы геномной ДНК клинических изолятов М. tuberculosis штамма H37Rv были выделены в лаборатории молекулярно-биологических исследований ГНЦ ПМ (Оболенск, Россия).
Методы.
Аллель-специфичная ПЦР.
АСИ ПЦР и АС ПЦР проводили используя в качестве матрицы примерно 10 нг геномной ДНК, объем реакционной смеси составлял 50 мкл. Реакционная смесь включала 40 мкМ каждого из дНТФ, 2 единицы Taq-полимеразы (Fermentas, Литва), 2 мМ MgS04, 25 мМ KCl, and 2% DMSO, в 10 мМ Трис-HCl, pH 8.85. ПЦР проводили в амплификаторе DNA Engine РТС-200 (MJ Research, Inc., USA).
Детекция мутаций в генах гроВ и katG.
Каждая реакция содержала пару праймеров для аллель-специфичного ампликона (фрагмента гена гроВ или katG) и пару праймеров для вспомогательного ампликона (фрагмента mtp40 или IS6110). Использовали следующие количества праймеров: 5 пМоль аллель-специфичных праймеров, по 10 пМоль праймеров для вспомогательного ампликона (mtpFor и mtpRev или ISFor и ISRev). Режим амплификации — начальная денатурация 96 °C 7 мин, затем 30−50 циклов 95 °C 40 сек, 62 °C 20 сек, 72 °C 1 мин. Результаты ПЦР анализировали электрофорезом в 1% агарозном геле. Последовательности праймеров представлены в Табл. 8.
Для определения превичной структуры участков генов гроВ использовали следущие праймеры: rSfor (GTCGGCGAGCTGATCCAAAAC), rSrev (GGTACGGCGTTTCGATGAACC), katG • kSfor (CTCCGCTGGAGCAGATGGGC), kSrev (TCTTCCAGGGTGCGAATGACCT).
Список литературы
- Neriich, A.G., Haas, C.J., Zink, A., Szeimies, U. and Hagedorn, H.G. (1997) Molecular evidence for tuberculosis in an ancient Egyptian mummy. Lancet, 350,1404.
- Salo, W.L., Aufderheide, A.C., Buikstra, J. and Holcomb, T.A. (1994) Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc Natl Acad Sei US A, 91,2091−4.
- Zink, A., Haas, C.J., Reischl, U., Szeimies, U. and Neriich, A.G. (2001) Molecular analysis of skeletal tuberculosis in an ancient Egyptian population. J Med Microbiol, 50,35 566.
- Smith, I. (2003) Mycobacterium tuberculosis pathogenesis and molecular determinants of virulence. Clin Microbiol Rev, 16,463−96.
- Raviglione, M.C., Snider, D.E., Jr. and Kochi, A. (1995) Global epidemiology of tuberculosis. Morbidity and mortality of a worldwide epidemic. JAMA, 273,220−6.
- Yerokhin, V.V., Punga, V.V. and Rybka, L.N. (2001) Tuberculosis in Russia and the problem of multiple drug resistance. Ann N YAcad Sei, 953,133−7.
- Liu, J., Barry, C.E., 3rd, Besra, G.S. and Nikaido, H. (1996) Mycolic acid structure determines the fluidity of the mycobacterial cell wall. J Biol Chem, 271,29 545−51.
- Brennan, P.J. and Nikaido, H. (1995) The envelope of mycobacteria. Annu Rev Biochem, 64,29−63.
- Engelhardt, H., Heinz, C. and Niederweis, M. (2002) A tetrameric porin limits the cell wall permeability of Mycobacterium smegmatis. J Biol Chem, 277,37 567−72.
- Stephan, J., Mailaender, C., Etienne, G., Daffe, M. and Niederweis, M. (2004) Multidrug resistance of a porin deletion mutant of Mycobacterium smegmatis. Antimicrob Agents Chemother, 48,4163−70.
- Elliott, A.M., Berning, S.E., Iseman, M.D. and Peloquin, C.A. (1995) Failure of drug penetration and acquisition of drug resistance in chronic tuberculous empyema. Tuber Lung Dis, 76,463−7.
- Gillespie, S.H. (2002) Evolution of drug resistance in Mycobacterium tuberculosis: clinical and molecular perspective. Antimicrob Agents Chemother, 46,267−74.
- Ramaswamy, S. and Musser, J.M. (1998) Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis, 79,3−29.
- Heep, M., Rieger, U., Beck, D. and Lehn, N. (2000) Mutations in the beginning of the rpoB gene can induce resistance to rifamycins in both Helicobacter pylori and Mycobacterium tuberculosis. Antimicrob Agents Chemother, 44,1075−7.
- Hirano, K., Abe, C. and Takahashi, M. (1999) Mutations in the rpoB gene of rifampin-resistant Mycobacterium tuberculosis strains isolated mostly in Asian countries and their rapid detection by line probe assay. J Clin Microbiol, 37,2663−6.
- Yuen, L.K., Leslie, D. and Coloe, P.J. (1999) Bacteriological and molecular analysis of rifampin-resistant Mycobacterium tuberculosis strains isolated in Australia. J Clin Microbiol, 37, 3844−50.
- Valim, A.R., Rossetti, M.L., Ribeiro, M.O. and Zaha, A. (2000) Mutations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis isolates from Brazil. J Clin Microbiol, 38, 3119−22.
- Matsiota-Bernard, P., Vrioni, G. and Marinis, E. (1998) Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Greece. J Clin Microbiol, 36,20−3.
- Mani, C., Selvakumar, N., Narayanan, S. and Narayanan, P.R. (2001) Mutations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis clinical isolates from India. J Clin Microbiol, 39,2987−90.
- Pozzi, G., Meloni, M., Iona, E., Orru, G., Thoresen, O.F., Ricci, M.L., Oggioni, M.R., Fattorini, L. and Orefici, G. (1999) rpoB mutations in multidrug-resistant strains of Mycobacterium tuberculosis isolated in Italy. J Clin Microbiol, 37,1197−9.
- Cavusoglu, C., Hilmioglu, S., Guneri, S. and Bilgic, A. (2002) Characterization of rpoB mutations in rifampin-resistant clinical isolates of Mycobacterium tuberculosis from Turkey by DNA sequencing and line probe assay. J Clin Microbiol, 40,4435−8.
- Yue, J., Shi, W., Xie, J., Li, Y., Zeng, E. and Wang, H. (2003) Mutations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis isolates from China. J Clin Microbiol, 41,2209−12.
- Hwang, H.Y., Chang, C.Y., Chang, L.L., Chang, S.F., Chang, Y.H. and Chen, Y.J. (2003) Characterization of nfampicin-resistant Mycobacterium tuberculosis in Taiwan. J Med Microbiol, 52, 239−45.
- Takayama, K., Wang, L. and David, H.L. (1972) Effect of isoniazid on the in vivo mycolic acid synthesis, cell growth, and viability of Mycobacterium tuberculosis. Antimicrob Agents Chemother, 2,29−35.
- Zhang, Y., Heym, B., Allen, B" Young, D. and Cole, S. (1992) The catalase-peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Nature, 358,591−3.
- Heym, B., Zhang, Y., Poulet, S., Young, D. and Cole, S.T. (1993) Characterization of the katG gene encoding a catalase-peroxidase required for the isoniazid susceptibility of Mycobacterium tuberculosis. J Bacteriol, 175,4255−9.
- Zhang, Y., Garbe, T. and Young, D. (1993) Transformation with katG restores isoniazid-sensitivity in Mycobacterium tuberculosis isolates resistant to a range of drug concentrations. Mol Microbiol, 8,521−4.
- Yu, S., Girotto, S., Lee, C. and Magliozzo, R.S. (2003) Reduced affinity for Isoniazid in the S315T mutant of Mycobacterium tuberculosis KatG is a key factor in antibiotic resistance. J Biol Chem, 278,14 769−75.
- Kapetanaki, S.M., Chouchane, S., Yu, S., Zhao, X., Magliozzo, R.S. and Schelvis, J.P. (2005) Mycobacterium tuberculosis KatG (S315T) catalase-peroxidase retains all active site properties for proper catalytic function. Biochemistry, 44,243−52.
- Banerjee, A., Dubnau, E., Quemard, A., Balasubramanian, V., Um, K.S., Wilson, T., Collins, D., de Lisle, G. and Jacobs, W.R., Jr. (1994) inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science, 263,227−30.
- Rouse, D.A., Li, Z., Bai, G.H. and Morris, S.L. (1995) Characterization of the katG and inhA genes of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother, 39,2472−7.
- Dessen, A., Quemard, A., Blanchard, J.S., Jacobs, W.R., Jr. and Sacchettini, J.C. (1995) Crystal structure and function of the isoniazid target of Mycobacterium tuberculosis. Science, 267,1638−41.
- Quemard, A., Sacchettini, J.C., Dessen, A., Vilcheze, C., Bittman, R., Jacobs, W.R., Jr. and Blanchard, J.S. (1995) Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis. Biochemistry, 34, 8235−41.
- Rozwarski, D.A., Grant, G.A., Barton, D.H., Jacobs, W.R., Jr. and Sacchettini, J.C. (1998) Modification of the NADH of the isoniazid target (InhA) from Mycobacterium tuberculosis. Science, 279, 98−102.
- Rawat, R., Whitty, A. and Tonge, P.J. (2003) The isoniazid-NAD adduct is a slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl reductase: adduct affinity and drug resistance. Proc Natl Acad Sei U SA, 100,13 881−6.
- Telenti, A., Honore, N., Bernasconi, C., March, J., Ortega, A., Heym, B., Takiff, H.E. and Cole, S.T. (1997) Genotypic assessment of isoniazid and rifampin resistance in
- Mycobacterium tuberculosis: a blind study at reference laboratory level. J Clin Microbiol, 35, 719−23.
- Slayden, R.A., Lee, R.E. and Barry, C.E., 3rd (2000) Isoniazid affects multiple components of the type II fatty acid synthase system of Mycobacterium tuberculosis. Mol Microbiol, 38,514−25.
- Mdluli, K., Slayden, R.A., Zhu, Y., Ramaswamy, S., Pan, X., Mead, D., Crane, D.D., Musser, J.M. and Barry, C.E., 3rd (1998) Inhibition of a Mycobacterium tuberculosis beta-ketoacyl ACP synthase by isoniazid. Science, 280,1607−10.
- Lee, A.S., Lim, I.H., Tang, L.L., Telenti, A. and Wong, S.Y. (1999) Contribution of kasA analysis to detection of isoniazid-resistant Mycobacterium tuberculosis in Singapore. Antimicrob Agents Chemother, 43,2087−9.
- Kelley, C.L., Rouse, D.A. and Morris, S.L. (1997) Analysis of ahpC gene mutations in isoniazid-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother, 41,2057−8.
- Miesel, L., Weisbrod, T.R., Marcinkeviciene, J.A., Bittman, R. and Jacobs, W.R., Jr. (1998) NADH dehydrogenase defects confer isoniazid resistance and conditional lethality in Mycobacterium smegmatis. J Bacteriol, 180,2459−67.
- Lee, A.S., Teo, A.S. and Wong, S.Y. (2001) Novel mutations in ndh in isoniazid-resistant Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother, 45,2157−9.
- Bercovier, H., Kafri, 0. and Sela, S. (1986) Mycobacteria possess a surprisingly small number of ribosomal RNA genes in relation to the size of their genome. Biochem Biophys Res Commun, 136,1136−41.
- Tracevska, T., Jansone, I., Nodieva, A., Marga, O., Skenders, G. and Baumanis, V. (2004) Characterisation of rpsL, rrs and embB mutations associated with streptomycin and ethambutol resistance in Mycobacterium tuberculosis. Res Microbiol, 155,830−4.
- Ramaswamy, S.V., Dou, S.J., Rendon, A., Yang, Z., Cave, M.D. and Graviss, E.A. (2004) Genotypic analysis of multidrug-resistant Mycobacterium tuberculosis isolates from Monterrey, Mexico. J Med Microbiol, 53,107−13.
- Meier, A., Sander, P., Schaper, K.J., Scholz, M. and Bottger, E.C. (1996) Correlation of molecular resistance mechanisms and phenotypic resistance levels in streptomycin-resistant Mycobacterium tuberculosis. Antimicrob Agents Chemother, 40,2452−4.
- Scorpio, A. and Zhang, Y. (1996) Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus. Nat Med, 2,662−7.
- Guo, M., Sun, Z. and Zhang, Y. (2000) Mycobacterium smegmatis has two pyrazinamidase enzymes, PncA and pzaA .J Bacteriol, 182,3881−4.
- Zhang, Y., Scorpio, A., Nikaido, H. and Sun, Z. (1999) Role of acid pH and deficient efflux of pyrazinoic acid in unique susceptibility of Mycobacterium tuberculosis to pyrazinamide. J Bacteriol, 181,2044−9.
- Sun, Z. and Zhang, Y. (1999) Reduced pyrazinamidase activity and the natural resistance of Mycobacterium kansasii to the antituberculosis drug pyrazinamide. Antimicrob Agents Chemother, 43,537−42.
- Sreevatsan, S., Pan, X., Zhang, Y., Kreiswirth, B.N. and Musser, J.M. (1997) Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob Agents Chemother, 41,636−40.
- Rodrigues Vde, F., Teiles, M.A., Ribeiro, M.O., Cafrune, P.I., Rossetti, M.L. and Zaha, A. (2005) Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis in Brazil. Antimicrob Agents Chemother, 49,444−6.
- Morlock, G.P., Crawford, J.T., Butler, W.R., Brim, S.E., Sikes, D., Mazurek, G.H., Woodley, C.L. and Cooksey, R.C. (2000) Phenotypic characterization of pncA mutants of Mycobacterium tuberculosis. Antimicrob Agents Chemother, 44,2291−5.
- Scorpio, A., Lindholm-Levy, P., Heifets, L., Gilman, R., Siddiqi, S., Cynamon, M. and Zhang, Y. (1997) Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis. Antimicrob Agents Chemother, 41, 540−3.
- Takayama, K., Armstrong, E.L., Kunugi, K.A. and Kilburn, J.O. (1979) Inhibition by ethambutol of mycolic acid transfer into the cell wall of Mycobacterium smegmatis. Antimicrob Agents Chemother, 16,240−2.
- Mikusova, K., Slayden, R.A., Besra, G.S. and Brennan, P.J. (1995) Biogenesis of the mycobacterial cell wall and the site of action of ethambutol. Antimicrob Agents Chemother, 39,2484−9.
- Takayama, K. and Kilburn, J.O. (1989) Inhibition of synthesis of arabinogalactan by ethambutol in Mycobacterium smegmatis. Antimicrob Agents Chemother, 33,1493−9.
- Telenti, A., Philipp, W.J., Sreevatsan, S., Bernasconi, C., Stockbauer, K.E., Wieles, B., Musser, J.M. and Jacobs, W.R., Jr. (1997) The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nat Med, 3,567−70.
- Lety, M.A., Nair, S., Berche, P. and Escuyer, V. (1997) A single point mutation in the embB gene is responsible for resistance to ethambutol in Mycobacterium smegmatis. Antimicrob Agents Chemother, 41,2629−33.
- Alcaide, F., Pfyffer, G.E. and Telenti, A. (1997) Role of embB in natural and acquired resistance to ethambutol in mycobacteria. Antimicrob Agents Chemother, 41,2270−3.
- Lee, A.S., Othman, S.N., Ho, Y.M. and Wong, S.Y. (2004) Novel mutations within the embB gene in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother, 48,4447−9.
- Lee, H.Y., Myoung, H.J., Bang, H.E., Bai, G.H., Kim, S.J., Kim, J.D. and Cho, S.N. (2002) Mutations in the embB locus among Korean clinical isolates of Mycobacterium tuberculosis resistant to ethambutol. Yonsei Med J, 43, 59−64.
- Plinke, C., Rusch-Gerdes, S. and Niemann, S. (2006) Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother, 50,1900−2.
- Kocagoz, T., Hackbarth, C.J., Unsal, I., Rosenberg, E.Y., Nikaido, H. and Chambers, H.F. (1996) Gyrase mutations in laboratory-selected, fluoroquinolone-resistant mutants of Mycobacterium tuberculosis H37Ra. Antimicrob Agents Chemother, 40,1768−74.
- Poole, K. (2000) Efflux-mediated resistance to fluoroquinolones in gram-positive bacteria and the mycobacteria. Antimicrob Agents Chemother, 44,2595−9.
- Li, X.Z., Zhang, L. and Nikaido, H. (2004) Efflux pump-mediated intrinsic drug resistance in Mycobacterium smegmatis. Antimicrob Agents Chemother, 48,2415−23.
- Pasca, M.R., Guglierame, P., Arcesi, F., Bellinzoni, M., De Rossi, E. and Riccardi, G. (2004) Rv2686c-Rv2687c-Rv2688c, an ABC fluoroquinolone efflux pump in Mycobacterium tuberculosis. Antimicrob Agents Chemother, 48,3175−8.
- Alangaden, G.J., Kreiswirth, B.N., Aouad, A., Khetarpal, M., Igno, F.R., Moghazeh, S.L., Manavathu, E.K. and Lerner, S.A. (1998) Mechanism of resistance to amikacin and kanamycin in Mycobacterium tuberculosis. Antimicrob Agents Chemother, 42,1295−7.
- Kruuner, A., Jureen, P., Levina, K., Ghebremichael, S. and Hoffner, S. (2003) Discordant resistance to kanamycin and amikacin in drug-resistant Mycobacterium tuberculosis. Antimicrob Agents Chemother, 47,2971−3.
- Taniguchi, H., Chang, B., Abe, C., Nikaido, Y., Mizuguchi, Y. and Yoshida, S.I. (1997) Molecular analysis of kanamycin and viomycin resistance in Mycobacterium smegmatis by use of the conjugation system. J Bacteriol, 179,4795−801.
- Suzuki, Y., Katsukawa, C., Tamaru, A., Abe, C., Makino, M., Mizuguchi, Y. and Taniguchi, H. (1998) Detection of kanamycin-resistant Mycobacterium tuberculosis by identifying mutations in the 16S rRNA gene. J Clin Microbiol, 36,1220−5.
- Maus, C.E., Plikaytis, B.B. and Shinnick, T.M. (2005) Mutation of tlyA confers capreomycin resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother, 49, 571−7.
- Johansen, S.K., Maus, C.E., Plikaytis, B.B. and Douthwaite, S. (2006) Capreomycin binds across the ribosomal subunit interface using tlyA-encoded 2'-0-methylations in 16S and 23S rRNAs. Mol Cell, 23,173−82.
- Bergmann, J.S. and Woods, G.L. (1998) Evaluation of the ESP culture system II for testing susceptibilities of Mycobacterium tuberculosis isolates to four primary antituberculous drugs. J Clin Microbiol, 36,2940−3.
- Roggenkamp, A., Hornef, M.W., Masch, A., Aigner, В., Autenrieth, I.B. and Heesemann, J. (1999) Comparison of MB/BacT and BACTEC 460 ТВ systems for recovery of mycobacteria in a routine diagnostic laboratory. J Clin Microbiol, 31,3711−2.
- Bemer, P., Bodmer, Т., Munzinger, J., Perrin, M., Vincent, V. and Drugeon, H. (2004) Multicenter evaluation of the MB/BACT system for susceptibility testing of Mycobacterium tuberculosis. J Clin Microbiol, 42,1030−4.
- Heym, В., Alzari, P.M., Honore, N. and Cole, S.T. (1995) Missense mutations in the catalase-peroxidase gene, katG, are associated with isoniazid resistance in Mycobacterium tuberculosis. Mol Microbiol, 15,235−45.
- Nash, K.A., Gaytan, A. and Inderlied, C.B. (1997) Detection of rifampin resistance in Mycobacterium tuberculosis by use of a rapid, simple, and specific RNA/RNA mismatch assay .J Infect Dis, 176,533−6.
- Watterson, S.A., Wilson, S.M., Yates, M.D. and Drobniewski, F.A. (1998) Comparison of three molecular assays for rapid detection of rifampin resistance in Mycobacterium tuberculosis. J Clin Microbiol, 36,1969−73.
- Troesch, A., Nguyen, H., Miyada, C.G., Desvarenne, S., Gingeras, T.R., Kaplan, P.M., Cros, P. and Mabilat, C. (1999) Mycobacterium species identification and rifampin resistance testing with high-density DNA probe arrays. J Clin Microbiol, 37,49−55.
- Torres, M.J., Criado, A., Palomares, J.C. and Aznar, J. (2000) Use of real-time PCR and fluorimetry for rapid detection of rifampin and isoniazid resistance-associated mutations in Mycobacterium tuberculosis. J Clin Microbiol, 38,3194−9.
- El-Hajj, H.H., Marras, S.A., Tyagi, S., Kramer, F.R. and Alland, D. (2001) Detection of rifampin resistance in Mycobacterium tuberculosis in a single tube with molecular beacons. J Clin Microbiol, 39,4131−7.
- Abate, G., Hoffner, S.E., Thomsen, V.O. and Miorner, H. (2001) Characterization of isoniazid-resistant strains of Mycobacterium tuberculosis on the basis of phenotypic properties and mutations in katG. Eur J Clin Microbiol Infect Dis, 20,329−33.
- Spindola de Miranda, S., Kritski, A., Filliol, I., Mabilat, C., Panteix, G. and Drouet, E. (2001) Mutations in the rpoB gene of rifampicin-resistant Mycobacterium tuberculosis strains isolated in Brazil and France. Mem Inst Oswaldo Cruz, 96,247−50.
- Cockerill, F.R., 3rd (1999) Genetic methods for assessing antimicrobial resistance. Antimicrob Agents Chemother, 43,199−212.
- Gibbs, R.A., Nguyen, P.N. and Caskey, C.T. (1989) Detection of single DNA base differences by competitive oligonucleotide priming. Nucleic Acids Res, 17, 2437−48.
- Giffard, P.M., McMahon, J.A., Gustafson, H.M., Barnard, R.T. and Voisey, J. (2001) Comparison of competitively primed and conventional allele-specific nucleic acid amplification. Anal Biochem, 292,207−15.
- Kainz, P. (2000) The PCR plateau phase towards an understanding of its limitations. Biochim Biophys Acta, 1494,23−7.
- Huang, M.M., Arnheim, N. and Goodman, M.F. (1992) Extension of base mispairs by Taq DNA polymerase: implications for smgle nucleotide discrimination in PCR. Nucleic Acids Res, 20,4567−73.
- Waterfall, C.M., Eisenthal, R. and Cobb, B.D. (2002) Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment. Biochem Biophys Res Commun, 299,715−22.
- Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C. and Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res, 17,2503−16.
- Mokrousov, I., Otten, T., Vyshnevskiy, B. and Narvskaya, O. (2003) Allele-specific rpoB PCR assays for detection of rifampin-resistant Mycobacterium tuberculosis in sputum smears. Antimicrob Agents Chemother, 47,2231−5.
- Del Portillo, P., Thomas, M.C., Martinez, E., Maranon, C., Valladares, B., Patarroyo, M.E. and Carlos Lopez, M. (1996) Multiprimer PCR system for differential identification of mycobacteria in clinical samples. J Clin Microbiol, 34, 324−8.
- Thierry, D., Brisson-Noel, A., Vincent-Levy-Frebault, V., Nguyen, S., Guesdon, J.L. and Gicquel, B. (1990) Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis. J Clin Microbiol, 28,2668−73.
- Parsons, L.M., Somoskovi, A., Urbanczik, R. and Salfinger, M. (2004) Laboratory diagnostic aspects of drug resistant tuberculosis. Front Biosci, 9,2086−105.
- Wada, T., Maeda, S., Tamaru, A., Imai, S., Hase, A. and Kobayashi, K. (2004) Dualprobe assay for rapid detection of drug-resistant Mycobacterium tuberculosis by real-time PCR. J Clin Microbiol, 42,5277−85.
- Glynn, J.R., Whiteley, J., Bifani, P.J., Kremer, K. and van Soolingen, D. (2002) Worldwide occurrence of Beijing/W strains of Mycobacterium tuberculosis: a systematic review. Emerg Infect Dis, 8, 843−9.
- Gamier, T., Eiglmeier, K., Camus, J.C., Medina, N., Mansoor, H., Pryor, M., Duthoy, S., Grondin, S., Lacroix, C., Monsempe, C. et al. (2003) The complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sei USA, 100,7877−82.
- Kovalev, S.Y., Kamaev, E.Y., Kravchenko, M.A., Kurepina, N.E. and Skorniakov, S.N. (2005) Genetic analysis of mycobacterium tuberculosis strains isolated in Ural region, Russian Federation, by MIRU-VNTR genotyping. IntJTuberc Lung Dis, 9, 746−52.
- Shemiakin, I.G., Stepanshina, V.N., Ivanov, I., Lipin, M., Korobova, O.V. and Anisimova, V.A. (2003) Characteristics of clinical isolates of Mycobacterium tuberculosis using molecular biological methods. Mol Gen Mikrobiol Virusol, 32−40.
- Yeh, R.W., Ponce de Leon, A., Agasino, C.B., Hahn, J.A., Daley, C.L., Hopewell, P.C. and Small, P.M. (1998) Stability of Mycobacterium tuberculosis DNA genotypes. J Infect Dis, ill, 1107−11.
- Niemann, S., Rusch-Gerdes, S., Richter, E., Thielen, H., Heykes-Uden, H. and Diel, R. (2000) Stability of IS6110 restriction fragment length polymorphism patterns of
- Chaves, F., Dronda, F., Alonso-Sanz, M. and Noriega, A.R. (1999) Evidence of exogenous reinfection and mixed infection with more than one strain of Mycobacterium tuberculosis among Spanish HIV-infected inmates. Aids, 13,615−20.
- Kruuner, A., Pehme, L., Ghebremichael, S., Koivula, T., Hoffner, S.E. and Mikelsaar, M. (2002) Use of molecular techniques to distinguish between treatment failure and exogenous reinfection with Mycobacterium tuberculosis. Clin Infect Dis, 35,146−55.
- Soim, H., Pan, X., Amin, A., Graviss, E.A., Siddiqui, A. and Musser, J.M. (2000) Characterization of Mycobacterium tuberculosis isolates from patients in Houston, Texas, by spoligotyping. J Clin Microbiol, 38,669−76.